DNA Sequencing Handbook
DNA Sequencing Facility
147 Biotechnology Building
Ithaca, NY 14853
607-254-4857
Hours: 8:00 am-4:00 pm
Monday through Friday
Description
DNA Sequencing is performed
using the Applied Biosystems Automated 3730xl DNA Analyzer. We use Big Dye
Terminator chemistry and AmpliTaq-FS DNA Polymerase. We routinely provide up to
900 bases per reaction, providing the template is of high quality.
Please note that our web page supercedes all written material. Please check our web site often for the most current information: http://www.brc.cornell.edu.
Revised 3/31/03
1. Orders will only be
accepted using our online ordering system
We no longer accept paper or faxed sequencing orders, so
please discard all of our old paper forms. All requests for sequencing must be
submitted electronically via our web based user interface, which can be reached
from our web site: http://www.brc.cornell.edu. Computers are available in our lab and
in the BRC Computing Facility for this purpose (or you may order from your own
computer). If you wish to use a
Purchase Order to pay for sequencing, we require a hard copy of the PO before
we can process your samples.
Samples utilizing custom primers must have the template DNA
and primer premixed (please be sure to place only one primer in each tube with the template
DNA). We will not mix your custom primers with your template DNA. We offer
M13F, M13R, T7HT, and T3HT universal primers. If you wish to use our universal
primers, please submit the template DNA and indicate which universal primer you
require on the electronic sample submission form. The universal primer will be added as part of the master mix
of sequencing reagents. There will be an additional $1 fee applied for this service. Please note that you must
supply a separate tube of the DNA for each universal primer that you wish to use.
Automated DNA sequencing on capillary format instruments
requires that the template be of higher purity than manual sequencing. Please
prepare your samples carefully. Inadequate DNA cleanup is the most common cause of poor
sequencing results.
Please provide us with the correct amount of sample, as
indicated below, for your sample type. We require these amounts so that we can
perform a rerun if needed and to ensure that our robot has an adequate volume
from which to pipet.
Place 1ug of plasmid DNA and 8 pmole of primer in a
screw cap vial, bring up to 18ul with H2O or low concentration
(10mM) pH9 Tris. Do not use TE.
For PCR products, place the
required amount of PCR product and 8 pmole of primer in a screw cap vial and
bring up to 18ul. To determine the
required amount of PCR product to add, use the following formula:
#base pairs/5.0 = amount of PCR
product in ng that we need
Example: 250bp PCR product.
250bp ÷ 5.0 = 50ng of DNA + 8 pmole primer in 18ul
(Note: The maximum PCR product
concentration is 100ng/ul).
Add the same amount of DNA as indicated above, but
only bring up to a volume of 10ul.
We will add the appropriate amount of universal
primer to the tube.
3. Sample vial
requirement
We accept
samples in two formats:
1. 500ul screw cap vials from Fisher Scientific (catalog number 05-669-20 or 05-669-25), VWR (catalog number 20170-223 or 20170-233), LPS (catalog number L233402), or Krackeler Scientific (catalog number 229-T338-2).
2.
Alternatively,
if you have large batches of samples, you may submit
them in 96 or 384 well plates. We prefer to receive large numbers of samples in
plates, rather than in individual tubes, as it allows us to process the samples
much more efficiently.
Plate submission policies:
4. New sample for each
sequence
Please
submit new samples with each order. Samples will be discarded one week after
they are processed and it has been determined that they do not need to be
rerun.
5.
Sample Drop off and Mailing
Samples
may be dropped off in room 147 of the Biotechnology Building from 8:00 am-4:00
pm, Monday through Friday. Samples
can be sent Fed Ex overnight or via US Mail; no ice is necessary for DNA. Our mailing address is 147
Biotechnology Building, Ithaca, NY 14853. Note that there is no Fed Ex delivery
on Saturdays or holidays. We have received numerous crushed tubes, so please
seal and cushion your tubes well before sending them.
Customers
from the Weill Medical College and Memorial Sloan Kettering Cancer Center in
NYC may submit their samples via their Fed Ex drop box. The Office of Sponsored
Programs manages the drop box, so please direct all questions regarding the
drop box to them. The office can be reached at 212-746-6020. Please
review the following guidelines. http://www.med.cornell.edu/research/cores/dna/
Specifically, to protect tubes from breaking in transit sample tubes should be
carefully wrapped in tissue and placed inside a 50 ml conical tube (e.g.,
Falcon BLUE MAX 2098 or Corning Orange capped tube). The requester's name,
contact number, lab location and order number should appear on the outside of
the package.
6. Sample Names
Sample names are limited to fifteen characters, consisting
of only letters and numbers. No spaces, periods, dashes, or symbols are
allowed. The name written on your
sample vial must exactly match the name of the sample on the online order.
Please be sure each tube is labeled correctly and completely; simply numbering
each tube is not acceptable.
All customers must submit a valid Cornell Account number,
Purchase Order number, or credit card number to which we can bill the
sequencing. We accept most major credit cards for our services, including Visa, Master Card, American
Express, Discover, and Cornell procurement cards. The Weill medical college
will need to submit a purchase order, we are not yet able to use your account
numbers. Service will not be
performed until we have a valid number to which we can charge. If you wish to
use a Purchase Order, we need a hard copy of the Purchase Order before we can
perform your sequencing (you may fax the PO to us at 607-254-4847). You may also set up a TAB account for all
services provided by the BioResource Center. The money must be provided up front and you will receive a
monthly notice of your expenditures and your balance. Please see our web site
for the current prices: http://www.brc.cornell.edu/brcinfo/Sequencing/prices.html.
Your
Sequencing Results
Our
usual turnaround time is 2 days. You can track the progress of your samples
from our web site: https://www.brc.cornell.edu/user/login.php. When your
results are ready, an email will be sent to you pointing you to our secure web
site where your electropherograms and text files can be viewed, printed, and
downloaded. Instructions for downloading and viewing your results are also
listed there. Results are stored
on the web for 30 days.
We archive all files for permanent storage. After results are no longer on the web,
files can be accessed again by contacting us with your order number. A $5 fee per order is associated with
data retrieval, so please remember to download and save your results as soon as
they are ready.
Analyzing
Your Results
Always
look at the electropherogram, not just the text file. The sequencing software calls the strongest signal (highest
peak) at any location. However, if
the noise level is high, weaker signals may not be distinguishable from the
background noise, resulting in questionable calls. Be sure that each peak is clearly stronger than any
background at that site. Please see the DNA Sequencing Home Page (http://www.brc.cornell.edu/brcinfo/Sequencing/index.html) for information on interpreting your data. The
BioResource Center Computing Facility (http://www.brc.cornell.edu/brcinfo/computing/index.html) can also provide software and support for primary
sequence analysis, which includes the use of confidence values for individual
base calls.
All samples that fail (meaning there is no readable
sequence) will be rerun automatically at no additional charge, using the
original samples. If you would
like any other sample rerun, you must resubmit the sample as a new order. Indicate on the new order that the
sample is a rerun and give us the order number from the sample's first use
(please do not combine samples from different orders onto the new order). If
this sample runs better the second time you will not be charged for this
reaction. If the result is the same or worse, you will be charged.
We encourage all users who are having problems sequencing
or who have questions about their results to come speak with us. So that we may
serve you best, please call us ahead of time to schedule a time to meet. To
assist us, please bring the following information with you: order numbers,
samples names, primer sequences, and any other relevant information concerning
the nature of the samples.
Fragment
Analysis
You can automatically determine the size of your DNA fragments, such as microsatellites (STRs), AFLPs, and RAPDs, and do mutation analysis such as SSCPs, using a fluorescence based detection system on our Applied BioSystems 3730xl DNA Analyzer. Please see the Fragment Analysis home page (http://www.brc.cornell.edu/brcinfo/dnafraganal/index.html) for more information.
Real Time
PCR
We
now have and ABI Prism 7900HT sequence detection system designed for real time
PCR. This instrument will
determine copy number of your target gene and also gene identification based on
fluorescent signaling. If you have
question on using this machine please see our real time home page (http://www.brc.cornell.edu/brcinfo/seqdetectpcr/index.html)
for more information.
Plasmid Sequencing
DNA Quality
The most important factor for successful DNA sequencing is
the quality of DNA used. Automated
sequencing with Taq polymerase is very sensitive to trace amounts of salts,
ethanol, proteins, and other contaminants. DNA that sequences well manually may not be pure enough for
automated sequencing. We recommend
that you use a commercial kit to prepare your DNA, such as those made by Qiagen
and Promega. Be sure to follow the directions exactly and do not overload
columns. Note that the purification outcome
is dependent on both the amount of DNA and the volume of liquid applied to the
column. We suggest that you stay well below the recommended volumes and
quantities.
Your DNA should meet the following tests for purity:
DNA Concentration
Determination
The easiest way to determine DNA concentration is to
measure the absorbance at 260. 1
OD ~ 50 ug/mL DS DNA. We have a UV
plate reader available for your use, free of charge.
Host Strain
The host strain used for your plasmid can affect the
sequence quality of the resulting DNA.
Vectors
Inserts in the vector pcDNAII can be difficult to sequence. If
you have persistent sequencing problems with this vector, try moving the insert
to another vector.
The AmpliTaq FS enzyme offers improved sequencing through
difficult templates, such as those with high G+C content, homopolymer regions,
and secondary structures. However,
it cannot always sequence these regions effectively. If you are having trouble with a high GC template and our
standard reaction cannot solve the problem, we can run the reaction with a
different chemistry (the dGTP Kit).
This is not a rerun, but will be considered a new reaction and
additional charges will apply. Secondary structure is the hardest problem to
overcome and often the solution is to sequence from the other end. We add 5%
DMSO to every sequencing reaction in an attempt to eliminate secondary
structure. Other options are also available, so please contact us if you are
having problems with secondary structure.
1. PCR Product
Sequencing
PCR
products must be purified before performing automated sequencing to remove PCR
primer carryover and excess dNTPs. We recommend
purifying PCR products with a commercial product available from Qiagen,
Promega, and other companies. Often, the desired PCR product is
contaminated with other amplification products, and gel purification is
necessary. We recommend that you
run your sample out on a gel and cut out and purify the band of interest.
Internal primers seem to work more reliably than the PCR
primers, as even gel purified PCR products may contain more than one
product. Using an internal primer
specific to the desired product results in less interference from secondary
sequences.
2. Phage Lambda, Cosmid,
and BAC Sequencing
Utilizing lambda, cosmid, and BAC DNA is less time
consuming than subcloning into smaller plasmids. Cosmid and BAC sequencing is
becoming more popular and the success rate is increasing. Please note on the online order form if
your DNA is phage, cosmid, lambda, or BAC and we will use a different chemistry
to help get a better signal. Please note that samples that require special
conditions may take a couple of extra days to process, and will cost an extra
$5 per reaction.
Primer length should be 17-25 nucleotides.
Be sure to choose a primer whose sequence is in your
vector. Also be sure that there is only one binding site for your primer.
The primer should match the template exactly.
Near the 3' end an exact match is essential, especially the
last 8 bases. When designing a
primer from a sequence obtained from the DNA Sequencing Facility remember that
sequence data beyond 500 bases is more likely to have errors than the first
50-500 bases. Unless you have
sequence information from the opposite strand or overlapping data from another
sequence, be conservative and choose your primer in the safer region, preceding
base 500. Degenerate primers are
not recommended.
2. Estimated Melting
Temperature (Tm)
Primers for cycle sequencing should have a Tm of
50-70°C, with the best at 55-65°C.
Please be aware that we add DMSO to each reaction, which
may lower both the Tm and annealing temperature of your primer. Our
thermocycling protocol anneals at 50°C and extends at 60°C. If the Tm of your primer is on the low side, please
consider redesigning a longer primer.
When the Tm is too low, the primer may anneal incorrectly or not at
all. A high Tm can be OK if
there are not long strings (>3) of Gs or Cs that can bind quickly, often
incorrectly, and very tightly.
Your G+C content should be approximately 50%.
Be aware that primer design software packages calculate Tms
based on some theoretical model that does not always yield actual experimental
Tms. Base stacking and nearest
neighbor models give the most accurate theoretical Tms. However, we have found that two fairly
simple equations can give useful results.
1. The McConaughy equation (Biochemistry 8: 3289-3295, 1969) modified for cycle sequencing:
Tm
= 60 + 41(G + C)/L - 500/L where L = length of primer
2. The Wallace
equation (Nucleic Acids Research 6: 3543-3557, 1979):
Td
= 2(A + T) + 4(G + C) (This is actually dissociation
temperature.)
Remember that all calculated Tms are only estimates. They are meant only as starting points
and do not guarantee success. We recommend that you avoid the extremes and choose a Tm
between 55-65°C, if possible.
The Tm of the 5' end should be similar to the Tm of the
3' end.
A quick way to determine the Tm at each end of the primer
is to count the number of A/T bases and C/G bases within 6 nucleotides of each
end. Choose the primer with the
most similar numbers. This will
help ensure that the primer anneals flat with the template strand.
Avoid primers that can form hairpin loops or
primer-dimers. Also avoid
stretches of more than 2 identical bases (especially C or G), particularly at
the 3' end. This can cause
slippage or mismatch during annealing, resulting in a bulge in the
primer/template hybrid which could prevent the polymerase from priming.
Many primer design programs are currently available from
our computing facility to assist you with primer design and evaluation.
These
primers can be requested for an additional $1.00 per reaction.
Primer name Length Sequence (5' to 3') Tm1 Tm 2
Forward:
M13F
(-21) 18 TGTAAAACGACGGCCAGT 53 54
T7HT* 22 GTAATACGACTCACTATAGGGC
56 64
Reverse:
M13
Rev 16 AACAGCTATGACCATG 47 46
T3HT* 20 AATTAACCCTCACTAAAGGG 51 56
*These high temperature (HT)
versions match many common vectors and are recommended for cycle
sequencing. Be sure to check the
sequence against your vector, as these primers differ from the commonly used
T7bs and T3 primers.
Tm 1 Estimated using the McConaughy equation
Tm 2 Estimated using the Wallace equation
Please be
sure your plasmid samples are compatible with our universal primers before
submitting samples for sequencing with our primers.
|
plasmid |
M13F |
M13R |
T7HT |
T3HT |
|
bibac |
N |
N |
N |
N |
|
pBlue-ks+/- |
Y |
Y |
Y |
Y |
|
pBlue-sk+/- |
Y |
Y |
Y |
Y |
|
pBlunt |
Y |
Y |
N |
N |
|
pBlunt2 |
Y |
Y |
N |
N |
|
pcDNA3.1 |
N |
Y |
N |
N |
|
PCR2.1-ta |
Y |
Y |
Y |
N |
|
pet-3 |
N |
N |
N |
N |
|
pet17 |
N |
N |
N |
N |
|
pet28a(+) |
N |
N |
N |
N |
|
pGem-t |
Y |
Y |
Y |
Y |
|
pGem3Zf(+) |
Y |
Y |
Y |
N |
|
PT7blue |
Y |
Y |
N |
N |
|
PT7T3 |
Y |
Y |
N |
Y |
|
ptracer cmv |
N |
Y |
N |
N |
|
pTrue Blue |
N |
N |
N |
N |
|
puc 18 |
Y |
Y |
N |
N |
|
puc 19 |
Y |
Y |
N |
N |
|
pZERO1 |
Y |
Y |
N |
N |
|
pZERO2 |
Y |
Y |
N |
N |