DNA Sequencing Handbook

 

DNA Sequencing Facility

147 Biotechnology Building

Ithaca, NY 14853

607-254-4857

Hours: 8:00 am-4:00 pm

Monday through Friday

 

 

 

Description

DNA Sequencing is performed using the Applied Biosystems Automated 3730xl DNA Analyzer. We use Big Dye Terminator chemistry and AmpliTaq-FS DNA Polymerase. We routinely provide up to 900 bases per reaction, providing the template is of high quality.

 

Please note that our web page supercedes all written material. Please check our web site often for the most current information: http://www.brc.cornell.edu.

 

 

Revised 3/31/03

Sample Submission

 

1. Orders will only be accepted using our online ordering system

We no longer accept paper or faxed sequencing orders, so please discard all of our old paper forms. All requests for sequencing must be submitted electronically via our web based user interface, which can be reached from our web site: http://www.brc.cornell.edu.  Computers are available in our lab and in the BRC Computing Facility for this purpose (or you may order from your own computer).  If you wish to use a Purchase Order to pay for sequencing, we require a hard copy of the PO before we can process your samples.

 

2. Premixed samples or universal primers only

Samples utilizing custom primers must have the template DNA and primer premixed (please be sure to place only one primer in each tube with the template DNA). We will not mix your custom primers with your template DNA. We offer M13F, M13R, T7HT, and T3HT universal primers. If you wish to use our universal primers, please submit the template DNA and indicate which universal primer you require on the electronic sample submission form.  The universal primer will be added as part of the master mix of sequencing reagents. There will be an additional  $1 fee applied for this service. Please note that you must supply a separate tube of the DNA for each universal primer that you wish to use.

Automated DNA sequencing on capillary format instruments requires that the template be of higher purity than manual sequencing. Please prepare your samples carefully. Inadequate DNA cleanup is the most common cause of poor sequencing results.

Please provide us with the correct amount of sample, as indicated below, for your sample type. We require these amounts so that we can perform a rerun if needed and to ensure that our robot has an adequate volume from which to pipet.

 

Preparation of premixed samples

Place 1ug of plasmid DNA and 8 pmole of primer in a screw cap vial, bring up to 18ul with H2O or low concentration (10mM) pH9 Tris. Do not use TE.

For PCR products, place the required amount of PCR product and 8 pmole of primer in a screw cap vial and bring up to 18ul.  To determine the required amount of PCR product to add, use the following formula:

#base pairs/5.0 = amount of PCR product in ng that we need

Example:  250bp PCR product.  250bp ÷ 5.0 = 50ng of DNA + 8 pmole primer in 18ul

(Note: The maximum PCR product concentration is 100ng/ul).

 

Preparation of samples for universal primer sequencing

Add the same amount of DNA as indicated above, but only bring up to a volume of 10ul.

We will add the appropriate amount of universal primer to the tube.

 

3. Sample vial requirement

We accept samples in two formats:

1.    500ul screw cap vials from Fisher Scientific (catalog number 05-669-20 or 05-669-25), VWR (catalog number 20170-223 or 20170-233), LPS (catalog number L233402), or Krackeler Scientific (catalog number 229-T338-2).

 

2.    Alternatively, if you have large batches of samples, you may submit them in 96 or 384 well plates. We prefer to receive large numbers of samples in plates, rather than in individual tubes, as it allows us to process the samples much more efficiently.

 

Plate submission policies:

 

4. New sample for each sequence

Please submit new samples with each order. Samples will be discarded one week after they are processed and it has been determined that they do not need to be rerun.

 

5. Sample Drop off and Mailing

Samples may be dropped off in room 147 of the Biotechnology Building from 8:00 am-4:00 pm, Monday through Friday.  Samples can be sent Fed Ex overnight or via US Mail; no ice is necessary for DNA.  Our mailing address is 147 Biotechnology Building, Ithaca, NY 14853. Note that there is no Fed Ex delivery on Saturdays or holidays. We have received numerous crushed tubes, so please seal and cushion your tubes well before sending them.

Customers from the Weill Medical College and Memorial Sloan Kettering Cancer Center in NYC may submit their samples via their Fed Ex drop box. The Office of Sponsored Programs manages the drop box, so please direct all questions regarding the drop box to them. The office can be reached at 212-746-6020. Please review the following guidelines. http://www.med.cornell.edu/research/cores/dna/ Specifically, to protect tubes from breaking in transit sample tubes should be carefully wrapped in tissue and placed inside a 50 ml conical tube (e.g., Falcon BLUE MAX 2098 or Corning Orange capped tube). The requester's name, contact number, lab location and order number should appear on the outside of the package.

 

6. Sample Names

Sample names are limited to fifteen characters, consisting of only letters and numbers. No spaces, periods, dashes, or symbols are allowed.  The name written on your sample vial must exactly match the name of the sample on the online order. Please be sure each tube is labeled correctly and completely; simply numbering each tube is not acceptable.

 

 

Billing Information

 

All customers must submit a valid Cornell Account number, Purchase Order number, or credit card number to which we can bill the sequencing.  We accept most major credit cards for our services, including Visa, Master Card, American Express, Discover, and Cornell procurement cards. The Weill medical college will need to submit a purchase order, we are not yet able to use your account numbers.  Service will not be performed until we have a valid number to which we can charge. If you wish to use a Purchase Order, we need a hard copy of the Purchase Order before we can perform your sequencing (you may fax the PO to us at 607-254-4847).  You may also set up a TAB account for all services provided by the BioResource Center.  The money must be provided up front and you will receive a monthly notice of your expenditures and your balance. Please see our web site for the current prices: http://www.brc.cornell.edu/brcinfo/Sequencing/prices.html.

 

 

Your Sequencing Results

 

Distribution

Our usual turnaround time is 2 days. You can track the progress of your samples from our web site: https://www.brc.cornell.edu/user/login.php. When your results are ready, an email will be sent to you pointing you to our secure web site where your electropherograms and text files can be viewed, printed, and downloaded. Instructions for downloading and viewing your results are also listed there.  Results are stored on the web for 30 days.

 

File Storage

We archive all files for permanent storage.  After results are no longer on the web, files can be accessed again by contacting us with your order number.  A $5 fee per order is associated with data retrieval, so please remember to download and save your results as soon as they are ready.

 

Analyzing Your Results

Always look at the electropherogram, not just the text file.  The sequencing software calls the strongest signal (highest peak) at any location.  However, if the noise level is high, weaker signals may not be distinguishable from the background noise, resulting in questionable calls.  Be sure that each peak is clearly stronger than any background at that site. Please see the DNA Sequencing Home Page (http://www.brc.cornell.edu/brcinfo/Sequencing/index.html) for information on interpreting your data. The BioResource Center Computing Facility (http://www.brc.cornell.edu/brcinfo/computing/index.html) can also provide software and support for primary sequence analysis, which includes the use of confidence values for individual base calls.

 

Rerun Policy

All samples that fail (meaning there is no readable sequence) will be rerun automatically at no additional charge, using the original samples.  If you would like any other sample rerun, you must resubmit the sample as a new order.  Indicate on the new order that the sample is a rerun and give us the order number from the sample's first use (please do not combine samples from different orders onto the new order). If this sample runs better the second time you will not be charged for this reaction. If the result is the same or worse, you will be charged.

 

Troubleshooting Meetings

We encourage all users who are having problems sequencing or who have questions about their results to come speak with us. So that we may serve you best, please call us ahead of time to schedule a time to meet. To assist us, please bring the following information with you: order numbers, samples names, primer sequences, and any other relevant information concerning the nature of the samples.

 

 

Special Services

 

Fragment Analysis

You can automatically determine the size of your DNA fragments, such as microsatellites (STRs), AFLPs, and RAPDs, and do mutation analysis such as SSCPs, using a fluorescence based detection system on our Applied BioSystems 3730xl DNA Analyzer. Please see the Fragment Analysis home page (http://www.brc.cornell.edu/brcinfo/dnafraganal/index.html) for more information.

 

Real Time PCR

            We now have and ABI Prism 7900HT sequence detection system designed for real time PCR.  This instrument will determine copy number of your target gene and also gene identification based on fluorescent signaling.  If you have question on using this machine please see our real time home page (http://www.brc.cornell.edu/brcinfo/seqdetectpcr/index.html) for more information.

 

Plasmid Sequencing

 

DNA Quality

The most important factor for successful DNA sequencing is the quality of DNA used.  Automated sequencing with Taq polymerase is very sensitive to trace amounts of salts, ethanol, proteins, and other contaminants.  DNA that sequences well manually may not be pure enough for automated sequencing.  We recommend that you use a commercial kit to prepare your DNA, such as those made by Qiagen and Promega. Be sure to follow the directions exactly and do not overload columns.   Note that the purification outcome is dependent on both the amount of DNA and the volume of liquid applied to the column. We suggest that you stay well below the recommended volumes and quantities.

Your DNA should meet the following tests for purity:

 

DNA Concentration Determination

The easiest way to determine DNA concentration is to measure the absorbance at 260.  1 OD ~ 50 ug/mL DS DNA.  We have a UV plate reader available for your use, free of charge.

 

Host Strain

The host strain used for your plasmid can affect the sequence quality of the resulting DNA.

 

 

Vectors

Inserts in the vector pcDNAII can be difficult to sequence. If you have persistent sequencing problems with this vector, try moving the insert to another vector.

 

 

Difficult Templates

 

The AmpliTaq FS enzyme offers improved sequencing through difficult templates, such as those with high G+C content, homopolymer regions, and secondary structures.  However, it cannot always sequence these regions effectively.  If you are having trouble with a high GC template and our standard reaction cannot solve the problem, we can run the reaction with a different chemistry (the dGTP Kit).  This is not a rerun, but will be considered a new reaction and additional charges will apply. Secondary structure is the hardest problem to overcome and often the solution is to sequence from the other end. We add 5% DMSO to every sequencing reaction in an attempt to eliminate secondary structure. Other options are also available, so please contact us if you are having problems with secondary structure.

 

1. PCR Product Sequencing

PCR products must be purified before performing automated sequencing to remove PCR primer carryover and excess dNTPs. We recommend purifying PCR products with a commercial product available from Qiagen, Promega, and other companies. Often, the desired PCR product is contaminated with other amplification products, and gel purification is necessary.  We recommend that you run your sample out on a gel and cut out and purify the band of interest.

Internal primers seem to work more reliably than the PCR primers, as even gel purified PCR products may contain more than one product.  Using an internal primer specific to the desired product results in less interference from secondary sequences.

 

2. Phage Lambda, Cosmid, and BAC Sequencing;

Utilizing lambda, cosmid, and BAC DNA is less time consuming than subcloning into smaller plasmids. Cosmid and BAC sequencing is becoming more popular and the success rate is increasing.  Please note on the online order form if your DNA is phage, cosmid, lambda, or BAC and we will use a different chemistry to help get a better signal. Please note that samples that require special conditions may take a couple of extra days to process, and will cost an extra $5 per reaction.

 

 

Guidelines for Primer Design

 

1. Specificity

Primer length should be 17-25 nucleotides.

Be sure to choose a primer whose sequence is in your vector. Also be sure that there is only one binding site for your primer.

 

The primer should match the template exactly. 

Near the 3' end an exact match is essential, especially the last 8 bases.  When designing a primer from a sequence obtained from the DNA Sequencing Facility remember that sequence data beyond 500 bases is more likely to have errors than the first 50-500 bases.  Unless you have sequence information from the opposite strand or overlapping data from another sequence, be conservative and choose your primer in the safer region, preceding base 500.  Degenerate primers are not recommended.

 

2. Estimated Melting Temperature (Tm)

Primers for cycle sequencing should have a Tm of 50-70°C, with the best at 55-65°C.

Please be aware that we add DMSO to each reaction, which may lower both the Tm and annealing temperature of your primer. Our thermocycling protocol anneals at 50°C and extends at 60°C.   If the Tm of your primer is on the low side, please consider redesigning a longer primer.  When the Tm is too low, the primer may anneal incorrectly or not at all.   A high Tm can be OK if there are not long strings (>3) of Gs or Cs that can bind quickly, often incorrectly, and very tightly.  Your G+C content should be approximately 50%.

Be aware that primer design software packages calculate Tms based on some theoretical model that does not always yield actual experimental Tms.  Base stacking and nearest neighbor models give the most accurate theoretical Tms.  However, we have found that two fairly simple equations can give useful results. 

 

1.    The McConaughy equation (Biochemistry 8: 3289-3295, 1969) modified for cycle sequencing:

 

            Tm = 60 + 41(G + C)/L - 500/L      where L = length of primer

 

2.  The Wallace equation (Nucleic Acids Research 6: 3543-3557, 1979):

 

            Td = 2(A + T) + 4(G + C)      (This is actually dissociation temperature.)

 

Remember that all calculated Tms are only estimates.  They are meant only as starting points and do not guarantee success.   We recommend that you avoid the extremes and choose a Tm between 55-65°C, if possible.

 

The Tm of the 5' end should be similar to the Tm of the 3' end. 

A quick way to determine the Tm at each end of the primer is to count the number of A/T bases and C/G bases within 6 nucleotides of each end.  Choose the primer with the most similar numbers.  This will help ensure that the primer anneals flat with the template strand.

 

3. Primer Sequence

Avoid primers that can form hairpin loops or primer-dimers.  Also avoid stretches of more than 2 identical bases (especially C or G), particularly at the 3' end.  This can cause slippage or mismatch during annealing, resulting in a bulge in the primer/template hybrid which could prevent the polymerase from priming. 

Many primer design programs are currently available from our computing facility to assist you with primer design and evaluation.

 

 

Universal Primers Available for DNA Sequencing

 

These primers can be requested for an additional $1.00 per reaction.

 

 

 

Primer name    Length     Sequence (5' to 3')        Tm1 Tm 2

Forward:        

            M13F (-21)     18                TGTAAAACGACGGCCAGT                        53       54

            T7HT*                22                GTAATACGACTCACTATAGGGC    56       64

Reverse:

            M13 Rev            16                AACAGCTATGACCATG                47       46

            T3HT*                20                AATTAACCCTCACTAAAGGG                    51       56

 

*These high temperature (HT) versions match many common vectors and are recommended for cycle sequencing.  Be sure to check the sequence against your vector, as these primers differ from the commonly used T7bs and T3 primers.

 

Tm 1  Estimated using the McConaughy equation

Tm 2  Estimated using the Wallace equation

 

 

Plasmid-Universal Primer Compatibility Chart

Please be sure your plasmid samples are compatible with our universal primers before submitting samples for sequencing with our primers.

 

plasmid

M13F

M13R

T7HT

T3HT

bibac

N

N

N

N

pBlue-ks+/-

Y

Y

Y

Y

pBlue-sk+/-

Y

Y

Y

Y

pBlunt

Y

Y

N

N

pBlunt2

Y

Y

N

N

pcDNA3.1

N

Y

N

N

PCR2.1-ta

Y

Y

Y

N

pet-3

N

N

N

N

pet17

N

N

N

N

pet28a(+)

N

N

N

N

pGem-t

Y

Y

Y

Y

pGem3Zf(+)

Y

Y

Y

N

PT7blue

Y

Y

N

N

PT7T3

Y

Y

N

Y

ptracer cmv

N

Y

N

N

pTrue Blue

N

N

N

N

puc 18

Y

Y

N

N

puc 19

Y

Y

N

N

pZERO1

Y

Y

N

N

pZERO2

Y

Y

N

N